Microsynth primers5/29/2023 The results are displayed as average ± standard deviation (n = 12). The GAG content was quantified using the DMMB dye binding assay with chondroitin-4-sulfate as standard. Total GAG (medium + scaffolds) production of hACPCs, seeded into fibrin-PU composite scaffolds, after 4 weeks of culture. * = Significant difference between control and BMP-2 (comparing unloaded to unloaded and loaded to loaded) # = significant difference between unloaded and loaded $ = significant difference between control unloaded and BMP-2 loaded, ( p ≤ 0. BMP-2) were conducted using the comparative ΔΔC T method and 18s RNA as internal control. The table displays the groups, in which Col II message was detected within the four runs of the experiment. Overview of Col II gene expression within the study. * = significant difference between control and BMP-2 (comparing unloaded to unloaded and loaded to loaded) # = significant difference between unloaded and loaded $ = significant difference between control unloaded and BMP-2 loaded, ( p ≤ 0. ALP) were conducted using the comparative ΔΔC T method and 18s RNA as internal control. # = significant difference between the control and the BMP-2 group (both loaded and unloaded) * = significant difference between control unloaded and control loaded $ = significantly different from the 3 days pre-culture time-point, ( p ≤ 0. The TGF-β1 concentration was determined using a quantitative ELISA for human TGF-β1. TGF-β1 concentration within the cell culture medium. *Significant difference from the 3 day pre-culture time-point # = loaded sample significantly different from day 1–7 time point $ = significant difference in the unloaded vs. The BMP-2 concentration was determined using a quantitative ELISA for human BMP-2. The primers and probes were designed and validated within our group using the primer express design software V.1.5 and were synthesized by Microsynth.īMP-2 concentration within the cell culture medium for control samples (red) and loaded samples (blue). Self-designed forward primers, reverse primers and probes used for real-time PCR. The round brackets surround the name of the primer, and the sequence is written in the 5' to 3' direction.īefore submitting, make sure your preferences below are set correctly.Overview of the eight different experimental groups, which were tested in the study. Input limit is 200,000,000Ĭagctggggggaggtggcgaggaagatgacgtggtcgaggtcgacggtatcgagttgtcgcggcagctgccaatacgactcactatagaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatctttagtgagggttaatcacctgctacttctcccgccacctcccīelow are Microsynth's standard primers that are available free of charge for Sanger sequencing. Paste a raw sequence or one or more FASTA sequences into Primer Map supports the entire IUPAC alphabet and Use this program to produceĪ useful reference figure, particularly when you haveĭesigned a large number of primers for a particular RestrictionĮndonuclease cut sites, and the protein translations of theĭNA sequence can also be shown. Showing the annealing positions of PCR primers. Primer Map accepts a DNA sequence and returns a textual map
0 Comments
Leave a Reply. |